This simulator will allow you to see what happens in a PCR reaction.

Question 1

In the simulator below, you will see a piece of 'template DNA'. Primer sequences have been made for you. The highlighted region of the template DNA is where the primers will bind. Using the temperature buttons and the Create primer buttons, simulate five cycles of a PCR reaction. Your tutor will help.

Question 2

This time the binding location is not highlighted, so you will have to find where the primers bind yourself. Perform three cycles, and show your tutor.

Question 3

This time we haven't given you the primer sequences. You will have to design them. Make primers that bind to the highlighted sites and perform three cycles. Primers should generally be at LEAST 18 bases long.

Question 4

Now you have to do everything yourself. Design primers that will amplify any part of this template.

Question 5

This time you can freely design primers, but there are some constraints. We need an amplicon that contains AT LEAST the highlighted 4 bases (but it can be larger).

Question 6

Usually, we only get to see the 5' > 3' top strand of the DNA (for example, genbank sequences and FASTA files). Try designing primers that match the highlighted regions below.

Question 7

Challenge time! It's all up to you this time. design primers that would amplify the large region of thymine using only the top strand sequence provided.

Question 8

Normally, we don't work with 3' > 5' sequences. However that doesn't stop lecturers putting them into exam questions to trick you. Design primers that will amplify the large guanine region, and watch out for tricky 3' > 5' sequences on exams.

Question 9

Can you do it without the simulator now? Design primers that amplify this ENTIRE template molecule. Do it without copying out the whole sequence. If you get really good at this, you might be able to do it in your head!

5' - GAATCTGAACCCTCAGATAGTGGGGATCCCGGGTATAGACCTTTATCTGCGGTCCAACTTAGGCATAAACCTGCATGCTACCTTGTCAGACCCACTCTGC - 3'

Question 10

this is what the genbank file looks like for human taste receptor gene Tas2R38. Note that genbank files are always 5' to 3'.

Can you design primers that would amplify the region from exactly base 421 to base 600?

LOCUS       NM_176817               1143 bp    mRNA    linear   PRI 22-JAN-2023
DEFINITION  Homo sapiens taste 2 receptor member 38 (TAS2R38), mRNA.
ACCESSION   NM_176817

        1 cctttctgca ctgggtggca accaggtctt tagattagcc aactagagaa gagaagtaga
       61 atagccaatt agagaagtga catcatgttg actctaactc gcatccgcac tgtgtcctat
      121 gaagtcagga gtacatttct gttcatttca gtcctggagt ttgcagtggg gtttctgacc
      181 aatgccttcg ttttcttggt gaatttttgg gatgtagtga agaggcaggc actgagcaac
      241 agtgattgtg tgctgctgtg tctcagcatc agccggcttt tcctgcatgg actgctgttc
      301 ctgagtgcta tccagcttac ccacttccag aagttgagtg aaccactgaa ccacagctac
      361 caagccatca tcatgctatg gatgattgca aaccaagcca acctctggct tgctgcctgc
      421 ctcagcctgc tttactgctc caagctcatc cgtttctctc acaccttcct gatctgcttg
      481 gcaagctggg tctccaggaa gatctcccag atgctcctgg gtattattct ttgctcctgc
      541 atctgcactg tcctctgtgt ttggtgcttt tttagcagac ctcacttcac agtcacaact
      601 gtgctattca tgaataacaa tacaaggctc aactggcaga ttaaagatct caatttattt
      661 tattcctttc tcttctgcta tctgtggtct gtgcctcctt tcctattgtt tctggtttct
      721 tctgggatgc tgactgtctc cctgggaagg cacatgagga caatgaaggt ctataccaga
      781 aactctcgtg accccagcct ggaggcccac attaaagccc tcaagtctct tgtctccttt
      841 ttctgcttct ttgtgatatc atcctgtgct gccttcatct ctgtgcccct actgattctg
      901 tggcgcgaca aaataggggt gatggtttgt gttgggataa tggcagcttg tccctctggg
      961 catgcagcca tcctgatctc aggcaatgcc aagttgagga gagctgtgat gaccattctg
     1021 ctctgggctc agagcagcct gaaggtaaga gccgaccaca aggcagattc ccggacactg
     1081 tgctgagaat ggacatgaaa tgagctcttc attaatacgc ctgtgagtct tcataaatat
     1141 gcc