This simulator will allow you to see what happens in a PCR reaction.
Question 1
In the simulator below, you will see a piece of 'template DNA'. Primer sequences have been made for you. The highlighted region of the template DNA is where the primers will bind. Using the temperature buttons and the Create primer buttons, simulate three cycles of a PCR reaction. Your tutor will help.
Question 2
This time we haven't given you the primer sequences. You will have to design them. Make primers that bind to the highlighted sites and perform enough cycles to check. Primers should generally be at LEAST 18 bases long.
Question 3
Now you have to do everything yourself. Design primers that will amplify any part of this template.
Question 4
Often, we need primers that "bracket" a region of DNA we want to test or sequence. In the example below, the 4 highlighted bases are a region of human DNA where a known disease mutation sometimes occurs. Your job is to design primers that "bracket" the highlighted region so a patient DNA can be tested for mutations. The primers not be too close to the mutation region because the PCR product will be too small.
Question 5
Usually, we only get to see the 5' > 3' top strand of the DNA (for example, genbank sequences and FASTA files). The DNA represented below would be double stranded in reality, but you should try designing primers that match the highlighted regions using ONLY the information in the top strand.
Question 6
Challenge time! It's all up to you this time. design primers that would bracket the large region of thymine using only the top strand sequence provided. Bracketing repetitive DNA regions like this is commonly used in DNA fingerprinting because the repeating region is often a different size in different people.
Question 7
Normally, we don't work with 3' > 5' sequences. However that doesn't stop lecturers putting them into exam questions to trick you. Design primers that will amplify the large guanine region, and watch out for tricky 3' > 5' sequences on exams.
Question 8
Can you do it without the simulator now? Design primers that amplify this ENTIRE template molecule. Do it without copying out the whole bottom strand. If you get really good at this, you might be able to do it in your head!
5' - GAATCTGAACCCTCAGATAGTGGGGATCCCGGGTATAGACCTTTATCTGCGGTCCAACTTAGGCATAAACCTGCATGCTACCTTGTCAGACCCACTCTGC - 3'
Question 9
This is what the genbank file looks like for human taste receptor gene Tas2R38. Note that genbank files are always 5' to 3'.
Can you design primers that would amplify the region from exactly base 421 to base 600?
LOCUS NM_176817 1143 bp mRNA linear PRI 22-JAN-2023
DEFINITION Homo sapiens taste 2 receptor member 38 (TAS2R38), mRNA.
ACCESSION NM_176817
1 cctttctgca ctgggtggca accaggtctt tagattagcc aactagagaa gagaagtaga
61 atagccaatt agagaagtga catcatgttg actctaactc gcatccgcac tgtgtcctat
121 gaagtcagga gtacatttct gttcatttca gtcctggagt ttgcagtggg gtttctgacc
181 aatgccttcg ttttcttggt gaatttttgg gatgtagtga agaggcaggc actgagcaac
241 agtgattgtg tgctgctgtg tctcagcatc agccggcttt tcctgcatgg actgctgttc
301 ctgagtgcta tccagcttac ccacttccag aagttgagtg aaccactgaa ccacagctac
361 caagccatca tcatgctatg gatgattgca aaccaagcca acctctggct tgctgcctgc
421 ctcagcctgc tttactgctc caagctcatc cgtttctctc acaccttcct gatctgcttg
481 gcaagctggg tctccaggaa gatctcccag atgctcctgg gtattattct ttgctcctgc
541 atctgcactg tcctctgtgt ttggtgcttt tttagcagac ctcacttcac agtcacaact
601 gtgctattca tgaataacaa tacaaggctc aactggcaga ttaaagatct caatttattt
661 tattcctttc tcttctgcta tctgtggtct gtgcctcctt tcctattgtt tctggtttct
721 tctgggatgc tgactgtctc cctgggaagg cacatgagga caatgaaggt ctataccaga
781 aactctcgtg accccagcct ggaggcccac attaaagccc tcaagtctct tgtctccttt
841 ttctgcttct ttgtgatatc atcctgtgct gccttcatct ctgtgcccct actgattctg
901 tggcgcgaca aaataggggt gatggtttgt gttgggataa tggcagcttg tccctctggg
961 catgcagcca tcctgatctc aggcaatgcc aagttgagga gagctgtgat gaccattctg
1021 ctctgggctc agagcagcct gaaggtaaga gccgaccaca aggcagattc ccggacactg
1081 tgctgagaat ggacatgaaa tgagctcttc attaatacgc ctgtgagtct tcataaatat
1141 gcc